Journal of Genetics & Genomic Sciences Category: Genetics Type: Research Article

IL6-174G/C (rs1800795) Polymorphism Rather than IL6R (rs2228145 and rs4845618 Polymorphisms is Associated with susceptibility to Rheumatoid Arthritis in the Belarusian Population

Siniauskaya Elizabeth1, Kuzhir Tatyana1, Yagur Victor2 and Goncharova Roza1*
1 Institute Of Genetics And Cytology, National Academy Of Sciences Of Belarus, 220072, 27 Akademicheskaya St., Minsk, Belarus
2 Belarusian State Medical University, Minsk, Belarus

*Corresponding Author(s):
Goncharova Roza
Institute Of Genetics And Cytology, National Academy Of Sciences Of Belarus, 220072, 27 Akademicheskaya St., Minsk, Belarus
Email:R.Goncharova@igc.by

Received Date: Dec 27, 2019
Accepted Date: Feb 10, 2020
Published Date: Feb 24, 2020

Abstract

Rheumatoid Arthritis (RA) is a chronic systemic disorder of the connective tissue of still unknown aetiology and complex autoimmune pathogenesis that primarily affects small joints. 

Interleukin-6 (IL6) is a pleiotropic cytokine with a crucial role in pathogenesis of Rheumatoid Arthritis (RA). Although IL6 involvement in development and clinical outcome of rheumatoid arthritis is well established, current investigations on association between Single Nucleotide Polymorphisms (SNPs) in the IL6 gene promoter region, such as IL6 −174G/C (rs1800795) and susceptibility to RA give somewhat conflicting results. 

Our preliminary study revealed significant association of IL6 −174G/C (rs1800795) with susceptibility to Juvenile Idiopatic Arthritis (JIA) in children and a higher frequency of the -174C allele in adult patients with RA, reaching statistical significance in case of RF-negative RA subtype. The aim of the present work was to evaluate association between IL6 −174G/C (rs1800795), IL6R (rs2228145, rs4845618) SNPs and RA in the Belarusian population, and determine possible correlations of these genetic variations with biological sex and autoantibody status. 

In the cohort of 187 RA patients and 380 healthy donors IL6 rs1800795 CC genotype had significantly higher frequency (p = 0.0456 OR 1.52 [1.02 - 2.27], recessive genetic model) among patients with rheumatoid arthritis as compared to that in controls. No associations of IL6R rs2228145 and rs4845618 SNPs with RA susceptibility were found in the total group of patients vs. controls, however the observed frequency of homozygous genotype TT for IL6R rs4845618) was significantly lower among male patients as compared to corresponding controls and female patients. It was also shown that IL6 rs1800795 CC genotype frequency was significantly higher among the patients with RF-negative status. Thus, we provide evidence for association of the non-synonymous variant IL6 −174G / C (rs1800795) with risk of RA in the Belarusian population, some features of interplay being revealed between gene polymorphisms analyzed and both gender of patients and RA antibody status.

Keywords

Autoantibody status; Gene polymorphism; IL6; Interleukin-6; Interleukin-6 receptor; IL6R; Rheumatoid arthritis; RF-negative RA; rs1800795; rs2228145; rs4845618

INTRODUCTION

According to the data of Johns Hopkins Arthritis Center, rheumatoid arthritis has a worldwide distribution with an estimated prevalence of 1 to 2% [1]. Prevalence increases with age, approaching 5% in women over age 55. The average annual incidence in the United States is about 70 per 100,000 annually. Women are two to three times more susceptible to RA than men. Although rheumatoid arthritis may occur at any age, patients most commonly are first affected in the third to sixth decades. 

In adults, arthritis is the leading cause of disability and work, physical and social activity limitations due to progressive joint damage. The number of people affected is predicted to increase by 40% in the USA over the next 25 years [2,3]. So distressing statistics and inefficient therapeutic treatment prompt scientists to search novel pathogenic pathways including molecular mechanisms underlying development of this multifactor and polygenic disease [4,5]. A significant part of the genetic component is represented by allelic variants of the highly polymorphic HLA (Human Leukocyte Antigen) locus, which (by some estimates) are found in 70% of RA patients [6]. Non-HLA genes were also shown to contribute to predisposition to this autoimmune disorder, among them, genes controlling inflammatory and autoimmune response are identified [7-9]. Due to Genome-Wide Association Study (GWAS) more than 200 genetic variants (single nucleotide polymorphisms, SNPs) were discovered to be involved in susceptibility to RA, and their range is permanently broadened [9]. It is typical, that most of genes are common for Caucasian and Asian populations, but some of them are specific to the Europeans, while others are specific to Asians. The cumulative data have indicated urgent need to study the problem of susceptibility to RA in the concrete ethno-geographic conditions. 

As an inflammatory disease, RA is characterized by increased levels in pro-inflammatory cytokines, which are secreted by immune cells and are vital part of the immune network to provide communication [10-12]. Interleukin-6 (IL6), a pleiotropic cytokine with multiple functions in different pathophysiologic systems including rheumatoid arthritis (RA), has a high priority among pro-inflammatory cytokines, fulfilling such functions as osteoclast and B-cell activation, T-cell proliferation and differentiation, acute-phase protein production [13]. High concentrations of IL6 in both the synovial fluid and serum of patients with RA suggested a major role of this cytokine in RA pathogenesis [14]. 

As a rule, cytokines carry out the functions interacting with specific receptors. Their level in biological fluids is known to be determined by expression of corresponded genes, which may be modulated by SNPs in the promoter region. Such effects are inherent, for example, to IL6 −174G/C polymorphism (rs1800795) [15]. However, the data regarding IL6 levels across −174G/C variants are controversial; some studies have shown higher circulating IL6 levels in GG carriers, whereas other studies have reported no difference between genotypes or even increased levels in CC carriers, suggesting the complicated mechanism in determining circulating IL6 level [15]. 

Impact of IL6 and IL6R polymorphisms on probability of developing RA was also studied with varying success. Although some case-control studies indicated increasing RA risk in carriers of the −174G/C (rs1800795) IL6 polymorphism, others, including the meta-analysis of GWAS data by Okada Y et al., have shown that no IL6 locus SNPs are associated with RA [8,16]. Our preliminary investigation revealed statistically significant association of the −174G/C IL6 polymorphism with juvenile idiopathic arthritis in children and a trend to higher frequency of the minor C allele in adult patients with RA [17]. 

In the light of all above, it was interesting to study the role of IL6 and IL6R polymorphisms (rs1800795; rs2228145; rs4845618) in developing RA in Belarusian population taking into account possible modulation of genetic effects due to etiologically important factors such as gender (biological sex) of patients and the antibody status.

MATERIALS AND METHODS

Study groups 

One hundred and eighty-seven Belarusian patients with RA (cases) and 380 healthy individuals without chronic inflammatory and autoimmune diseases (controls: F/M: 285/95, mean age 37.18 ± 10.69 years) were recruited in the Scientific-Practical Center of Surgery, Transplantation and Hematology (Minsk). Patients with RA were included into the case-group due to the verified diagnosis of RA according classification diagnostic criteria of the American College of Rheumatology (1987, ACR; formerly, the American Rheumatism Association) and the classification criteria by ACR\EULAR 2010 [18,19]. Detailed diagnosis was made on the basis of clinical and laboratory instrumental examinations. Informed consent was obtained from all participants, who were also interviewed for some demographic characteristics, pernicious habits and anamnesis. Clinical and serological (RF and anti-CCP antibody status) data on RA patients were collected from individual disease history. RA was deemed seropositive in case of rheumatoid factor (RF) and anti-cyclic citrullinated peptide (anti-CCP) antibodies’ serum levels exceeded reference values (for RF positivity:≥30 IU/ml, for anti-CCP positivity: ≥5 U/ml). 

SNP genotyping 

Total genomic DNA was isolated from peripheral blood samples using standard phenol-chloroform DNA extraction protocol [20]. Samples were genotyped for selected SNPs by real-time PCR using fluorescent probes (Primetech ALC, Minsk, Belarus) (Table 1). Rs1800795 (which is more often referred to as “−174G/C”) is located in the promoter region (−174) of IL6 gene. Among two selected SNPs of IL6R, rs2228145 is a missense variant p.Asp358Ala and rs4845618 is an intronic variant. All PCR and endpoint fluorescent readings were performed using Bio-rad CFX 96 real-time PCR detection system (Bio-Rad, Hercules, CA). Thermal cycling was initiated at 95°C for 10 min, followed by varying number of cycles of denaturation at 95°C for 15 sec, annealing at SNP-specific t°C for 30 sec and extension at 72°C for 30 sec. 

SNP

Forward primer, 5′→3′

Reverse primer, 5′→3′

Probe, 5′→3′

Annealing, (°C)

L6 rs1800795

CGACCTAAGCTGCACTTTTCC

GGGCTGATTGGAAACCTTATTAAGATTG

FAM– CCTTTAGCATCGCAAGAC

62

ROX –CCTTTAGCATGGCAAGAC

IL6R rs2228145

TCTCCTCTTCCTCCTCTATCT

CAGGCTCCCTCCAGCAA

FAM– AGCTTCTTCTTCAGTACCACTG

61

ROX –AGATTCTTCTTCAGTACCACTG

IL6R , rs4845618

CTGCACGGTGACAATTCAAC

CTTCACACTTCCCTCTCACTTTA

FAM –CTTATATCTGTCCCTTTTCGCC

55

ROX – CTTATATCTTTCCCTTTTCGCC

Table 1: Summary of oligonucleotide primers/probes and annealing temperature used for real-time PCR-based genotyping.

 

Statistical analysis

Allele and genotype frequencies of IL6/IL6R SNPs were obtained by direct counting. For allele and genotype frequency comparisons, we used χ2 test with 2×2 contingency tables. Odds Ratios (ORs) and 95% confidence intervals (95% CIs) were calculated using Vassar Stats online tool [21]. Genetic model analysis was further utilized to confirm the association of the genotype. P-values of < 0.05 (two-tailed) were considered statistically significant.

RESULTS

A total of 187 samples from RA patients were analyzed for association between IL6 and IL6R SNPs (rs1800795, rs4845618 and rs2228145) and risk of developing RA. IL6 rs1800795 was successfully genotyped in 380 healthy controls, whereas rs4845618 and rs2228145 were genotyped in 324 and 284 controls respectively. Demographic and serological characteristics of patients diagnosed with RA are summarized in table 2. 

Characteristics

Value

No. of patients

187

Age, mean ± SD years

58.2 ± 11.9

Disease duration, mean ± SD years

13.2 ± 11.1

Female no. (%)

148 (79)

Male, no. (%)

39 (21)

Rheumatoid factor positive, RF (+), no. (%)

117 (62.6)

Rheumatoid factor negative, RF (-), no. (%)

50 (26.7)

No RF data available, no. (%)

20 (10.69)

Anti–cyclic citrullinated peptide antibody positive, anti-CCP (+), no. (%)

144 (77.0)

Anti–cyclic citrullinated peptide negative, anti-CCP (-), no. (%)

35 (18.7)

No ACCP data available, no. (%)

8 (4.28)

 Table 2: Demographic characteristics and serological status of RA patients included in the study.

The data show that the total sample of patients is predominantly represented by women (79%), the average age is 58.2 ± 11.9 years. RF and anti-CCP levels were evaluated in 167 and 179 patients, respectively. RF and anti-CCP antibody positivity usually coincide, but there were 18 cases when anti-CCP (+) combined with RF (-), and combination of RF (+) with anti-CCP (-) was observed in 5 cases. 

Genotype/allele frequency distributions were as shown in table 3. Utilizing recessive genetic model we found an association between CC genotype of IL6 rs1800795 and RA as compared to controls (OR = 1.52 [1.02 - 2.27] p 0.0456; table 3). Stratification for gender of the patients with RA had shown that the potential RA risk CC genotype of rs1800795 also manifested in female patients when compared with female controls. 

When genotyping IL6R rs4845618 and rs2228145 loci, no significant differences were revealed in the distribution of the allele/genotype frequencies. Results of analysis for IL6R SNPs in the RA group were consistent with data on allele/genotype frequency distribution of these variants in Belarusian children with JIA [17]. However, there were differences in distribution of TT genotype frequencies of IL6R rs4845618 in men: TT genotype frequencies were somewhat lower in male patients versus corresponding controls and when comparing with female patients. Similar data were observed in relation to frequency distribution of IL6R rs2228145 CC genotype (Table 3). 

SNP

Geno-type/ allele

Total

Men

Women

RA patients, n (%)

Controls, n (%)

RA patients, n (%)

Controls, n (%)

RA patients, n (%)

Controls, n (%)

rs1800795

(IL6)

GG

50 (26.46)

112 (29.47)

11 (28.2)

30 (31.58)

39 (26)

82 (28.77)

GC

85 (44.97)

189 (49.74)

17 (43.6)

42 (44.21)

68 (45.33)

147 (51.58)

CC

54 (28.57)1

79 (20.79)

11 (28.2)

23 (23.21)

43 (28.67)2

56 (19.65)

G

185 (48.94)

413 (54.34)

39 (50)

102 (53.68)

146 (48.67)

311 (54.56)

C

193 (51.06)

347 (45.66)

39 (50)

88 (46.32)

154 (51.33)

259 (45.44)

rs2228145

(IL6R)

AA

80 (42.33)

118 (41.5)

19 (48.72)

36 (37.89)

61 (40.67)

82 (43.38)

AC

91 (48.15)

128 (45.1)

19 (48.72)

45 (47.37)

72 (48)

83 (43.92)

CC

18 (9.52)

38 (13.4)

1 (2.56)3

14 (14.74)

17 (11.33)

24 (12.7)

A

251 (66.4)

364 (64.1)

57 (73.08)

117 (61.58)

194 (64.67)

247 (65.34)

C

127 (33.6)

204 (35.9)

21 (26.92)

73 (38.42)

106 (35.33)

131 (32.66)

rs4845618

(IL6R)

GG

43 (22.75)

78 (24.1)

11 (28.2)

22 (23.16)

32 (21.33)

56 (24.45)

GT

102 (53.97)

167 (51.5)

24 (61.54)

47 (49.47)

78 (52)

120 (52.4)

TT

44 (23.28)

79 (24.4)

4 (10.26) 4,5

26 (27.37)

40 (26.67)

53 (23.15)

G

188 (49.74)

323 (49.85)

46 (58.97)

91 (47.89)

142 (47.33)

232 (50.65)

T

190 (50.26)

325 (50.15)

32 (41.03)

99 (52.11)

158 (52.67)

226 (49.35)

 Table 3: Case-control analysis of distribution of genotype\allele frequencies of studied SNPs also stratified by sex. 

1 - recessive genetic model (rec.), overall cases vs. controls p = 0.0456 OR=1.52 95%CI [1.02 - 2.27]; 2 - rec., female patients vs. female controls p = 0.04 OR=1.64 95%CI [1.039 – 2.60]; 3 - rec., male patients vs. male controls p = 0.074 OR=0.15 95%CI [0.0193 – 1.2007]; 4 - rec., male cases vs. male controls p = 0.039 OR=0.30 95%CI [0.0981 – 0.9375]; 5 – rec., male patients vs. female patients p = 0.033 OR=0.31 95%CI [0.105 - 0.9404]

At the next step of our investigation we attempted to analyze a possible association of studied SNPs with RA clinical parameters, namely serological status (Table 4). The data indicated that CC genotype of IL6 rs1800795 was associated with RF (-) RA. The rest of genetic variants were neutral with respect to RA risk independently of serological status of patients. 

SNP

Genotype/ allele

RF+, n (%)

RF-, n (%)

anti-CCP+, n (%)

anti-CCP-, n (%)

Controls, n (%)

rs1800795 (IL6)

GG

34 (29.06)

11 (22)

34 (23.61)

12 (34.29)

112 (29.47)

GC

54 (46.15)

20 (40)

68 (47.22)

15 (42.86)

189 (49.74)

CC

29 (24.79)

19 (38)1

42 (29.17)

8 (22.85)

79 (20.79)

CC+GC

83 (70.94)

39 (78)

110 (76.39)

23 (65.71)

268 (70.53)

C

112 (47.86)

58 (58)

152 (52.78)

31 (44.29)

347 (45.66)

rs2228145 (IL6R)

AA

50 (42.74)

23 (46)

63 (43.75)

15 (42.86)

118 (41.5)

AC

58 (49.57)

19 (38)

66 (45.83)

17 (48.57)

128 (45.1)

CC

9 (7.69)

8 (16)

15 (10.42)

3 (8.57)

38 (13.4)

CC+AC

67 (57.26)

27 (54)

81 (56.25)

20 (57.14)

166 (58.5)

C

76 (32.48)

35 (35)

96 (33.33)

23 (32.86)

204 (35.9)

rs4845618 (IL6R)

GG

24 (20.51)

14 (28)

31 (21.53)

10 (28.57)

78 (24.1)

GT

67 (57.26)

21 (42)

80 (55.56)

15 (42.86)

167 (51.5)

TT

26 (22.22)

15 (30)

33 (22.92)

10 (28.57)

79 (24.4)

TT+GT

93 (79.49)

36 (72)

113 (78.47)

25 (71.43)

246 (75.93)

T

119 (50.85)

51 (51)

146 (50.69)

35 (50)

325 (50.15)

Table 4: Distribution of IL6, IL6R genotypes/alleles among Belarusian RA patients with varying serological status as compared to healthy controls.

RF+ - Rheumatoid Factor positive; RF- - Rheumatoid Factor-negative; anti-CCP+ - anti-CCP Antibody-Positive; anti-CCP- - anti-CCP Antibody-Negative. 

1 - Genotypic test, CC IL6 rs1800795 in RF (-) RA patients vs. controls p = 0.0019

DISCUSSION

Our case-control study demonstrated an association of IL6 promoter -174G/C (rs1800795) polymorphism with increased RA risk. The carries of the CC genotype were more susceptible to developing RA (OR = 1.52 [1.02 - 2.27] p 0.0456), and this difference was also significant in women. In the same time, studied SNPs in IL6R locus showed no association with RA in the total cohort with inverse effects in men (p = 0.074 OR=0.15 [0.0193 - 1.2007] for the CC genotype of rs2228145 in men as compared to corresponding controls and p = 0.039 OR=0.30 (0.0981 - 0.9375) for TT genotype of rs4845618. 

As mentioned above, the data concerning IL6 SNPs associations with RA are contradictory. There are similar conflicting data with respect to IL6 levels affected by IL6 −174G/C (rs1800795). Marinou et al. found that the IL-6 -174 major allele is associated with radiographic damage and disease activity [22]. However, RF and anti-CCP status was not associated with IL6 genotypes. In Polish patients, the frequency distribution in the same locus (rs1800795) was similar in the RA and control groups, but homozygotes by the minor C allele associated with highest average concentration of the cytokine and disease activity. On this ground, the authors have concluded that CC homozygosity may play a rather unfavorable role in RA [23]. 

Although a majority of independent investigations in different European populations did not reveal the positive association of the IL6 rs1800795 polymorphism with RA, meta-analysis of Asian populations demonstrated such association (OR = 9.75, 95%CI [4.99-19.06], p <0.00001) [24]. The data on European and Asian populations were included in further meta-analysis which showed the statistically significant association between IL6 (rs1800795) -174 C allele and RA in the combined population (OR = 1.59; 95%CI: 1.19-2.14, P < 0.05), the similar effect for GC+ CC genotypes [15]. In Asians, positive associations were found in carriers of −174C allele as well as for CC and GC+CC genotypes. Therefore, the contribution of the IL6 rs1800795 minor allele to developing RA seems quite convincing. 

A set of individual case-control studied indicated the positive association between the level of circulating IL6 cytokine and its soluble receptor and RA [25-29]. However, the data on how the IL6 rs1800795 variant affects the level and activity of the cytokine are contradictory. For example, JIA patients, carriers of the major G allele had the increased level of this cytokine [30]. On the other hand, levels of IL6 cytokine were increased in RA adult patients, carriers of the C minor allele [31]. Utilizing Mendelian randomization, Bing Li et al. concluded that “carriers of the IL6 -174 GC+CC genotype showed significant reduction in the circulating IL-6 level (WMD = -0.77; 95% CI: -1.16 to -0.38; p = 0.000) when compared with carriers of GG genotype. Conversely, a significantly increased circulating IL6 level (WMD = 0.64; 95% CI: 0.26-1.03; p = 0.001) was observed in carriers of GG+GC genotype compared with carriers of the CC genotype” [15]. Seemingly in contrast with these effects, the IL6 -174 minor allele and relative genotypes were risk variants for developing RA [15]. Thus, a negative causal relevance of circulating IL6 level with RA risk in overall and Asian populations was demonstrated that indicated intricate regulation of IL6 gene expression contributing to disease development.

Investigations by Noss et al., and Isomaki et al., provided some information elucidating this genetic puzzle [32,33]. Noss et al., reported a striking reproducible association between the IL6 promoter SNP rs1800795 CC genotype and high IL6 production by synovial fibroblasts and absence of such association in monocytes. The data obtained indicated the alternative effects of IL6 polymorphisms depending on cell types and a prominent impact of IL6 SNP rs1800795 on regulation of this cytokine in fibroblasts [32]. Isomaki et al., demonstrated a higher level of circulating IL6 in blood of patients with RA as compared with healthy volunteers due to constitutive activation of transcription STAT3 [33]. However, IL6-induced STAT3 phosphorylation was found to occur only in a certain fraction of T cells from RA patients whereas in some patients the response to IL6 stimulation was comparable to that in healthy controls. By authors' opinion, these results show that the IL6/STAT3 pathway is involved in the initiation and progression of RA, but in individual-dependent manner. 

Additionally, although RF status and anti-ACPA status were not associated with genetic variants of IL6 (rs1800795), we revealed a positive association between the IL6 proximal promoter SNP rs1800795 CC genotype and RF-negative status [22]. In support of our data, some studies has shown that IL6-driven STAT signaling is observed particularly in early ACPA negative patients [34,35]. In this context, it should be noted that significant association was observed between IL6 -174C allele and early disease onset of RA [36].

In conclusion, when taking together the literature findings and our own data, it seems that importance of IL6 (rs1800795) −174C allele and its related genotypes in development of RA is rather convincing. However, further investigations to elucidate complex mechanisms of interleukin-6/interleukin-6 receptor networking in development of RA are required.

ACKNOWLEDGEMENT

The authors would like to thank patients and volunteers who participated in this study, and Hanna Yatskiv and Darya Balshakova, members of our laboratory and our medical colleagues.

CONFLICT OF INTEREST

The authors ES Siniauskaya, TD Kuzhir, VE Yagur, RI Goncharova declare that they have no conflict of interest to disclose.

REFERENCES

  1. Ruffing V, Bingham CO (2020) Rheumatoid Arthritis Signs and Symptoms. Johns Hopkins Arthritis Center, Baltimore, USA.
  2. Helmick CG, Felson DT, Lawrence RC, Gabriel S, Hirsch R, et al. (2007) Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. Part I. Arthritis Rheum 58: 15-25.
  3. Smolen JS, Aletaha D, McInnes IB (2016) Rheumatoid arthritis. Lancet 388: 2023-2038.
  4. Karami J, Aslani S, Jamshidi A, Garshasbi M, Mahmoudi M. (2019) Genetic implications in the pathogenesis of rheumatoid arthritis; an updated review. Gene 702: 8-16.
  5. Kuzhir TD (2019) Polygenic nature of rheumatoid arthritis. Ecological Genetics 17: 75-88.
  6. Ärlestig L, Mullazehi M, Kokkonen H, Rocklöv J, Rönnelid J, et al. (2012Antibodies against cyclic citrullinated peptides of IgG, IgA and IgM isotype and rheumatoid factor of IgM and IgA isotype are increased in unaffected members of multicase rheumatoid arthritis families from northern Sweden. Ann Rheum Dis 71: 825-829.
  7. Kurkó J, Besenyei T, Laki J, Glant TT, Mikecz K, et al. (2013) Genetics of rheumatoid arthritis - a comprehensive review. Clin Rev Allergy Immunol 45: 170-179.
  8. Okada Y, Wu D, Trynka G, Raj T, Terao C, et al. (2014) Genetics of rheumatoid arthritis contributes to biology and drug discovery. Nature 506: 376-381.
  9. Zhu H, Xia W, Mo XB, Lin X, Qiu YH, et al. (2016) Gene-based genome-wide association analysis in European and Asian populations identified novel genes for rheumatoid arthritis. PLoS One 11: e0167212.
  10. Magyari L, Varszegi D, Kovesdi E, Sarlos P, Farago B, et al. (2014) Interleukins and interleukin receptors in rheumatoid arthritis: Research, diagnostics and clinical implications. World J Orthop 5: 516-536.
  11. Kasama, T, Isozaki T, Takahashi R, Miwa Y (2016) Clinical effects of tocilizumab on cytokines and immunological factors in patients with rheumatoid arthritis. Int Immunopharmacol 35: 301-306.
  12. Nalbant S, Birlik AM (2017) Cytokines in Rheumatoid Arthritis (RA). In: Lazaros I Sakkas (eds.). New Developments in the Pathogenesis of Rheumatoid Arthritis. IntechOpen, London, UK.
  13. Nishimoto N, Kishimoto T (2006) Interleukin 6: from bench to bedside. Nat Clin Pract Rheumatol 2: 619-626.
  14. Hashizume M, Mihara M (2011) The Roles of Interleukin-6 in the Pathogenesis of Rheumatoid Arthritis. Arthritis 2011: 1-8.
  15. Li B, Xiao Y, Xing D, Ma XL, Liu J (2016) Circulating interleukin-6 and rheumatoid arthritis: A Mendelian randomization meta-analysis. Medicine 95: 3855.
  16. Amr K, El-Awady R, Raslan H (2016) Assessment of the −174G/C (rs1800795) and −572G/C (rs1800796) Interleukin 6 Gene Polymorphisms in Egyptian Patients with Rheumatoid Arthritis. Open Access Maced J Med Sci 4: 574-577.
  17. Yatskiu H, Balshakova D, Tchitchko A, Yagur V, Sukalo A, et al. (2018) Influence of –l74GlC IL-6 gene polymorphism on the susceptibility to rheumatoid arthritis in children and adults in the Republic of Belarus. Doklady of the National Academy of Sciences of Belarus 62: 608-614.
  18. Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF, et al. (1988) The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum 31: 315-24.
  19. Aletaha D, Neogi T, Silman AJ, Funovits J, Felson DT, et al. (2010) 2010 Rheumatoid arthritis classification criteria: an American College of Rheumatology/European League Against Rheumatism collaborative initiative. Ann Rheum Dis 69: 1580-1588.
  20. Sambrook J, Russell DW (2001) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, USA.
  21. http://vassarstats.net/
  22. Marinou I, Healy J, Mewar D, Moore DJ, Dickson MC, et al. (2007) Association of interleukin-6 and interleukin-10 genotypes with radiographic damage in rheumatoid arthritis is dependent on autoantibody status. Arthritis Rheum 56: 2549-2556.
  23. Wielinska J, Dratwa M, Swierkot J, Korman L, Iwaszko M, et al. (2018) Interleukin 6 gene polymorphism is associated with protein serum level and disease activity in Polish patients with rheumatoid arthritis. HLA 2: 38-41.
  24. Li F, Xu J, Zheng J, Sokolove J, Zhu K, et al. (2014) Association between interleukin-6 gene polymorphisms and rheumatoid arthritis in Chinese Han population: a case-control study and a meta-analysis. Sci Rep 4: 5714.
  25. Hirano T, Matsuda T, Turner M, Miyasaka N, Buchan G, et al. (1988) Excessive production of interleukin 6/B cell stimulatory factor-2 in rheumatoid arthritis. Eur J of Immunol 18: 1797-1802.
  26. Dasgupta B, Corkill M, Kirkham B, Gibson T, Panayi G (1992) Serial estimation of interleukin 6 as a measure of systemic disease in rheumatoid arthritis. J Rheumatol 19: 22-25.
  27. Madhok R, Crilly A, Watson J, Capell HA (1993) Serum interleukin 6 levels in rheumatoid arthritis: correlations with clinical and laboratory indices of disease activity. Ann Rheum Dis 52: 232-234.
  28. Robak T, Gladalska A, Stepien H, Robak E (1998) Serum levels of interleukin-6 type cytokines and soluble interleukin-6 receptor in patients with rheumatoid arthritis. Mediators Inflamm 7: 347-353.
  29. Dayer JM, Choy E (2010) Therapeutic targets in rheumatoid arthritis: the interleukin-6 receptor. Rheumatology 49: 15-24.
  30. Fishman D, Faulds G, Jeffery R, Mohamed-Ali V, Yudkin JS, et al. (1998) The effect of novel polymorphisms in the interleukin-6 (IL-6) gene on IL-6 transcription and plasma IL-6 levels, and an association with systemic-onset juvenile chronic arthritis. J Clin Invest 102: 1369-1376.
  31. Panoulas VF, Stavropoulos-Kalinoglou A, Metsios GS, Smith JP, Milionis HJ, et al. (2009) Association of interleukin-6 (IL-6)-174G/C gene polymorphism with cardiovascular disease in patients with rheumatoid arthritis: The role of obesity and smoking. Atherosclerosis 204: 178-183.
  32. Noss EH, Nguyen HN, Chang SK, Watts GF, Brenner MB (2015) Genetic polymorphism directs IL-6 expression in fibroblasts but not selected other cell types. Proc Natl Acad Sci USA 112: 14948-14953.
  33. Isomäki P, Junttila I, Vidqvist KL, Korpela M, Silvennoinen O (2015) The activity of JAK-STAT pathways in rheumatoid arthritis: constitutive activation of STAT3 correlates with interleukin 6 levels. Rheumatology 54: 1103-1113.
  34. Pratt AG, Swan DC, Richardson S, Wilson G, Hilkens CM, et al. (2012) A CD4 T cell gene signature for early rheumatoid arthritis implicates interleukin 6-mediated STAT3 signalling, particularly in anti-citrullinated peptide antibody-negative disease. Ann Rheum Dis 71: 1374-81.
  35. Anderson AE, Pratt AG, Sedhom MA, Doran JP, Routledge C, et al. (2016) IL-6-driven STAT signalling in circulating CD4+ lymphocytes is a marker for early anticitrullinated peptide antibody-negative rheumatoid arthritis. Ann Rheum Dis 75: 566-73.
  36. Pascual M, Nieto A, Matarán L, Balsa A, Pascual-Salcedo D, et al. (2000) IL-6 promoter polymorphisms in rheumatoid arthritis. Genes Immun 1: 338-340.

Citation: Siniauskaya E, Kuzhir T, Yagur V, Goncharova R (2020) IL6 −174G/C (rs1800795) Polymorphism Rather than IL6R (rs2228145 and rs4845618) Polymorphisms is Associated with Susceptibility to Rheumatoid Arthritis in the Belarusian Population. J Genet Genomic Sci 5: 015.

Copyright: © 2020  Siniauskaya Elizabeth, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

© 2021, Copyrights Herald Scholarly Open Access. All Rights Reserved!