India is well known for its cultural, social, ecological and genetic diversity in South Asia. Uttar Pradesh and Bihar states were one of oldest population habitat in central east region of India. In the present study, we explored pigmentation (melanin index) diversity of 6872.649 km2 and 2736.333 km2 regions of Uttar Pradesh and Bihar states of India respectively. We found high pigmentation diversity and wide presence of major mitochondrial haplogroups in small region of Indian subcontinent, which might be true for all geographical region of South-Asia. Further, we correlated the melanin index with social status (General (GN), Other Backward Classes (OBC) and Scheduled Castes (SC)) and mitochondrial haplogroups. The melanin index is marginally different between OBC and SC (p = 0.0142) while significantly different from GN vs OBC (p = 3.33 × 10-12) and GN vs SC (p < 2 × 10-16). We did not observe any significant differences between melanin index of one haplogroup against another haplogroup; (a) M vs U, p = 0.0845, (b) M vs R, p = 0.895, (c) M vs L, p = 0.513, (d) U vs R, p = 0.258, (e) U vs L, p = 0.635 and (f) R vs L, p = 0.613. Our study reveals that cast populations of central east India, represent significantly different melanin index and diverse mitochondrial haplogroup. Our study signifies that mitochondrial haplogroups, do not have any genetic influence on melanin index. However, further study on larger cohort, will elucidate, more about diversity and pigmentation relation in India.
Indian subcontinent represents 1/6 of total world population. India is well known for its cultural, social and ecological diversity. It is also one of the most genetically diverse geographical regions, which consists of 4,635 anthropologically well-defined groups, who were following endogamy marriage practices from thousands of years [1-3].
Geographical regions of India, Sri Lanka, Myanmar, Bangladesh, Bhutan, Nepal, Tibet (China), Afghanistan and Pakistan constitute together the Indian subcontinent regions. Indian subcontinent also referred as South Asian region and encompasses the highest genetic diversity after Africa. This is because, during the out of Africa migration of Homo sapiens, the Indian subcontinent has acted as an incubator for populations, who then spread and colonized the world [1-3]. Being the central of these countries, India is considered as a major corridor for the dispersal of modern human [1-3]. It has been studied that Indian populations largely constitute the same gene pool [2-5].
In population genetic studies, we study several populations based on their genetic characteristics. Here we study the DNA marker based on mitochondrial Hyper Variable Region (HVR). We study mitochondrial markers to find out genetic diversity and evolutionary process among populations [6]. Indian population is complex in terms of diversity of languages affiliation, ancestry and various other phenotype parameters [1,2]. Human genetics and environment plays together for shaping skin pigmentation variations. Whatever huge pigmentation variation we observed across the world, is largely shaped by different levels of UV radiations [7]. Pigmentation studies were helpful in understanding the evolutionary processes. Study shows that role of melanin is very important in pigmentation variation, where it is performing dual role and make delicate balance between the skin being light enough at low UVR zones (to allow sufficient production of vitamin D) and dark enough at high UVR zones (for protection against sun burn and degradation of folate) [8-10]. Any imbalance between these dual procedures would have wide-range of effects on human health (reproductive fitness, skin cancer, anaemia, fetal abnormalities, spermatogenesis, rickets and vitamin D deficiency) [9].
There were several pigmentation studies revealing association with pigmentation candidate gene in South Asia and they have approved the act of natural selection process of human populations [7-12]. Previous report, observed the significant association with rs1426654, with skin pigmentation in populations living specifically in India [8]. Recent study on same region (middle gangetic regions of central east part of India) had well established the association with pigmentation diversity and the populations [13,14]. The central east region of India is one of the most fertile and densely populated regions (http://www.censusindia.gov.in). This region represents more than hundreds ethnic groups and considered as a one of the oldest continuously inhabited places in the world [15]. The central east populations were living in one of the oldest and continuously habituated regions of India. These populations further explore and spread to various parts of India. Traditionally these populations were divided into various casts depending on old Hindu mythology. Religiously Muslim populations were also present dominantly in same region. Various subjects were categorized based on their specific cast and described as cast populations due to presence of endogamy pattern. Cast populations were also based on traditional Indian system of “work based population groups” or more specifically “Chaturvarna”, which included Brahmins (practices teaching and religious rites), Kshatriyas (warriors or defendants), Vaishyas (traders, artisans) and Shudras (smaller activities). Further these casts were divided among sub casts or region specific population groups and identified by their surnames or gotras (ancestor name). They maintain their unique socio-cultural identity due to strict endogamy, specific rituals and marriage practices, which provide genetic differentiation due to isolation or specific environment due to passage of time. Additionally, regional and social effect also play key role in shaping regional sub cast populations, which makes ultimately cast system more complicated. Currently, various cast populations were further politically divided in to General (GN), Other Backward Classes (OBC), Scheduled Castes (SC) and Scheduled Tribes (ST). This division was according to socioeconomic status of various casts of the society by the Constitution of India. In the present study, we have analyzed the data based on above broad category, which gives general implication of social cast system of India. Since, evolutionary background of many populations is still not clear so, we have discussed in brief about evolutionary background of some important populations based on their phenotype and mtDNA study. It was interesting to observe highly diverse skin pigmentation and wide presence of major Mitochondrial haplogroups (MT-haplogroup) in central east populations. In the present study, we want to, explore the relation of pigmentation and genetic diversity of central-east Indian cast populations.
Sample details and their phenotype data collection
Figure 2: Geographical region of study in Indian region. Total 1078 subject of17 populations were used for study (http://wiienvis.nic.in).
Population | Study database | Subjects | References |
Cohort 1 | Phenotype | 1078 | [13,14] |
Cohort 2 | Phenotype-genotype | 184 | This study |
S. No. | Population | State | Sample size | Average MI | Std dev. | Social category |
1 | Brahmin | Uttar Pradesh and Bihar | 99 | 47.997 | (+/-) 7.882 | General |
2 | Bhumihar | Uttar Pradesh and Bihar | 54 | 46.45185 | (+/-) 5.104557 | General |
3 | Srivastava (Kayasth) | Uttar Pradesh | 13 | 48.23077 | (+/-) 6.678714 | General |
4 | Prasad | Bihar | 16 | 57.42188 | (+/-) 9.551771 | Other Backward Class |
5 | Kshatriya | Uttar Pradesh and Bihar | 30 | 51.35833 | (+/-) 8.296126 | General |
6 | Muslim | Bihar | 83 | 58.38916 | (+/-) 8.3316 | Religion |
7 | Kurmi (Patel / Singh) | Uttar Pradesh | 26 | 57.62692 | (+/-) 8.626937 | Other Backward Class |
8 | Rai (Yadav, Bihar) | Bihar | 144 | 59.3814 | (+/-) 9.8346 | Other Backward Class |
9 | Sah | Bihar | 61 | 61.31148 | (+/-) 9.770941 | Other Backward Class |
10 | Mahto | Bihar | 130 | 62.35577 | (+/-) 10.07836 | Other Backward Class |
11 | Sahni | Bihar | 76 | 63.14276 | (+/-) 8.407975 | Schedule Caste |
12 | Ram | Bihar | 95 | 63.34737 | (+/-) 9.799078 | Schedule Caste |
13 | Paswan | Bihar | 117 | 63.7641 | (+/-) 9.777141 | Schedule Caste |
14 | Thakur | Bihar | 35 | 64.20455 | (+/-) 8.506986 | Other Backward Class |
15 | Bhagat | Bihar | 24 | 66.75417 | (+/-) 10.2636 | Other Backward Class |
16 | Manjhi | Bihar | 72 | 70.83403 | (+/-) 8.126759 | Schedule Caste |
17 | Prajapati | Uttar Pradesh | 3 | 49 | (+/-) 1.5 | Other Backward Class |
S. No. | Population | State | Sample size | Social category |
1 | Brahmin | Uttar Pradesh and Bihar | 42 | General |
2 | Bhumihar | Uttar Pradesh and Bihar | 19 | General |
3 | Srivastava (Kayasth) | Uttar Pradesh | 2 | General |
4 | Prasad | Bihar | 4 | Other Backward Class |
5 | Kshatriya | Uttar Pradesh and Bihar | 2 | General |
6 | Muslim | Bihar | 11 | Religion |
7 | Kurmi (Patel / Singh) | Uttar Pradesh | 4 | Other Backward Class |
8 | Rai (Yadav, Bihar) | Bihar | 17 | Other Backward Class |
9 | Sah | Bihar | 8 | Other Backward Class |
10 | Mahto | Bihar | 17 | Other Backward Class |
11 | Sahni | Bihar | 10 | Schedule Caste |
12 | Ram | Bihar | 14 | Schedule Caste |
13 | Paswan | Bihar | 13 | Schedule Caste |
14 | Thakur | Bihar | 4 | Other Backward Class |
15 | Bhagat | Bihar | 5 | Other Backward Class |
16 | Manjhi | Bihar | 9 | Schedule Caste |
17 | Prajapati | Uttar Pradesh | 3 | Other Backward Class |
Primer Name | Forward Primer | Reverse Primer |
Mito 23rd | TCATTGGACAAGTAGCATCC | GAGTGGTTAATAGGGTGATAG |
Mito 22nd | TGAAACTTCGGCTCACTCCT | AGCTTTGGGTGCTAATGGTG |
Mito 18th | TATCACTCTCCTACTTACAG | AGAAGGATATAATTCCTACG |
Mito 15th | TCTCCATCTATTGATGAGGGTCT | AATTAGGCTGTGGGTGGTTG |
Table 2: Details of the primer utilized for non-coding mitochondrial region amplification in the present study.
Steps | Denaturation | 35 Cycles | Final | Hold | ||
Final | Annealing | Extension | Extension | |||
Denaturation | ||||||
Temperature (?C) | 95 | 95 | 58 | 72 | 72 | 4 |
Time (minutes) | 5:00 | 1:00 | 0:30 | 2:00 | 7:00 | 10:00 |
Steps | Denaturation | 35 Cycles | Final | Hold | ||
Final | Annealing | Extension | Extension | |||
Denaturation | ||||||
Temperature (?C) | 95 | 95 | 58 | 72 | 72 | 4 |
Time (minutes) | 5:00 | 1:00 | 0:30 | 2:00 | 7:00 | 10:00 |
Table 3: Details of the PCR conditions used for mitochondrial study.
Diversity of skin pigmentation
Figure 3: Box plot to represent the distribution of melanin index in different social categories of Central East Indian cast populations in cohort 1. Total 1078 subjects of 17 populations were used for study.
S. No. | Population | Sample Size | State | Social category | Haplogroups assigned | |||||||||
1 | Brahmin | 42 | Uttar Pradesh and Bihar | GN | M37 | M5a | L1c1a1 | L1c2a1a | L1c4 | M | M1 | A2a5 | L2b1a4 | T2e |
M1a1b | M2a1 | M35b | M37 | M37e | M38d | M40a1 | M6a1a | M15 | M27a | |||||
R30b1 | M7b1a1i | M7c1a1 | R31a | R6b | T | U | U5b2a2 | |||||||
2 | Bhumihar | 19 | Uttar Pradesh and Bihar | GN | G2a1c1 | L1c1a1 | M | M1 | M12b1a | M2a1 | M3 | M30 | ||
M34a1 | M7b1a1i | M7c2 | T1a13 | M31a2 | ||||||||||
3 | Srivastava | 2 | Uttar Pradesh | GN | M1 | |||||||||
4 | Prasad | 4 | Bihar | OBC | L4a | M7c1a1 | ||||||||
5 | Kshatriya | 2 | Uttar Pradesh | GN | U5a2b2 | |||||||||
6 | Muslim | 11 | Bihar | RELIGION | H14 | L1c1b | L2 | M1 | M13b2 | M33d | M43 | M43b | M6a1a | M7b1a1i |
7 | Kurmi | 4 | Uttar Pradesh | OBC | M13 | U2a | ||||||||
8 | Yadav | 17 | Uttar Pradesh and Bihar | OBC | M2a1 | M5a | M30d | U2a | M35a | M3d1 | M77 | M7b1a1i | U7 | U6b1 |
JT | M30c1 | |||||||||||||
9 | Sah | 8 | Bihar | OBC | L1c4a | M1 | M27a | M39a2 | M8a | |||||
10 | Mahto | 17 | Bihar | OBC | M1 | M1a1b | M21b2 | M28 | M3 | M3 | M38d | M5a | ||
M5a | M5b2 | M7b1a1i | ||||||||||||
11 | Sahni | 10 | Bihar | SC | M1 | M23 | M33a1a | M6a1b | M7b1a1i | M8a2'3 | T1a | U | U2b | |
12 | Ram | 14 | Bihar | SC | G2a1e | M1 | M30c1 | M4 | M40 | U5a1 | M5a | T2 | U2b | R30a |
13 | Paswan | 13 | Bihar | SC | L2c2a | M1 | M35b | M36c | M7b1a1i | M7c1a1 | R30b1 | R30b1a | U2a1 | U2b |
U5a1i | ||||||||||||||
14 | Thakur | 4 | Bihar | OBC | M3d1 | M7b1a1i | U2a | |||||||
15 | Bhagat | 5 | Bihar | OBC | M30c1a | M30d | U2a | |||||||
16 | Manjhi | 9 | Bihar | SC | L1c1a2 | L1c1d | M30c | R6 | U2a | U2b2 | U3a | |||
17 | Prajapati | 3 | Uttar Pradesh | OBC | L1c1d | R5a2 |
Table 4: Genotype-phenotype database of central-east Indian cast populations also referred as cohort 2. Cast populations were defined in terms of average Melanin Index (MeI), social categories and geographical states of India. Total 184 subjects of 17 populations were used for study. (GN- General; OBC-Other Backward Class; SC-Schedule Cast).
Major Haplo Group | Sample Size | Geographical Specific or Dominance | Central East Cast Populations |
L | 14 | Africa (central and south) | Majhi, Paswan, Bhumihaar, Brahmin, Muslim, Sah, Prasad and Prajapati |
M | 123 | Asia (east and south); Africa (east) | Ram, Paswan, Muslim, Sahni, Mahto, Prasad and Srivastava-Kayasth |
Majhi, Bhumihaar, Brahmin, Yadav, Thakur and Sah | |||
R | 11 | Asia (south) | Majhi, Brahmin, Ram, Prajapati and Paswan |
T | 5 | Europe; Asia (central); Africa (north) | Majhi, Bhumihaar, Brahmin, Ram and Sahni, |
U | 26 | Europe; Asia (north and central); Africa (north) | Majhi, Paswan, Ram, Thakur, Khatriya, Kurmi, Bhagat and Sahni |
In conclusion, we found high pigmentation and mitochondrial haplogroup diversity in central East Indian populations. Although, pigmentation is significantly different among social categories, we did not find any significant influence on major MT-haplogroup.
Sheikh Nizamuddin was supported by ICMR-Senior Research fellowship program. Anshuman Mishra acknowledges the financial support of “DBT-RA program P90806” of Department of Biotechnology, India; UGC-SRF fellowship and contingency grant of BHU, India and “2016 Post-Doc. Development Program” of Pusan National University, South Korea. Study group acknowledges Rakesh Narayan Dubey (Prasad Intermediate College, Varanasi), Dhruva Narayan Dubey (Bhartiya Vidya Adhyan Kendra, Varanasi), Ashutosh Narayan Mishra (Bhopal) for all kind of help and arrangements. Special Thanks to Genome Foundation, Hyderabad for sequencing facility and Professor Martha Mizoran Lahr (University of Cambridge) for derma spectrophotometer instruments.
Authors declare no conflict of interest.
BOX: Key Facts about Mitochondrial Research The human, genome comprises nuclear genome and mitochondrial genome. During zygote formation, nuclear genome is contributed by a sperm cell and mitochondrial genome by the unfertilized egg cell (Figure 5). The mitochondrial genome is maternally inherited (circular double stranded molecule of ~16569 bases). Everyone carries more or less exact copy of the mtDNA. These mtDNA they get from their mother and their mother’s mother and so on, thus representing countless generations (maternal inheritance). We can trace any random mutation over the mtDNA, as these mutations are passed on intact to next generation; they were considered as “tracers of the subjects or family or populations”. Further details of mitochondrial research (genome structure, transcription, translation and replication) were well described by Jan-Willem Taanman [21]. In the past few years, the characterization and comparison of molecular signatures based on mtDNA have provided a substantial contribution to the understanding of human origins, their genetic relatedness and diffusion patterns [3,6,8,22,23]. Mitochondrial DNA surveys in worldwide populations have shown a continent-specific distribution of mtDNA lineages [6,22-26]. All Eurasian mtDNA lineages trace their ancestry to three maternal founder lineages M, N (R), suggesting their dispersal along the southern route in single wave after the exodus of modern humans from Africa [3,17,22-24,27]. The coalescence times of mtDNA haplogroups M, N and R are remarkably similar and ancient, ~65,000 years [17,18]. |
Figure 5: Schematic presentation of Mitochondria inheritance pattern in biological cell (source: dr.mishra@zmail.com).
Citation: Nizamuddin S, Gupta G, Mishra A, Yashvardhini N, Pandey S, et al. (2016) Skin Pigmentation Diversity in Central-East Indian Populations and its Correlation with Mitochondrial Haplogroups. J Genet Genomic Sci 1: 005.
Copyright: © 2016 Sheikh Nizamuddin, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.